AICS-0113
SNPNM_0027470.4(MYH3):c.2306G>T(p.Gly769Val)
Gene SymbolMYH3
Gene Namemyosin heavy chain 3
Parental LineAICS-0075 cl. 85 ACTN2
Clone NumberClone TypeReplicateGenotype
cl.2MutantAG769V/WT
cl.23ControlAWT/WT
cl.30MutantAG769V/WT
cl.44ControlAWT/WT
cl.57ControlBWT/WT
cl.82MutantBG769V/WT
Certificate of Analysis

Obtain AICS-0113

3 mutant clones3 isogenic controls

AICS-0113

MYH3 in WTC-mEGFP-ACTN2 (mono-allelic tag)
Representative images for all clones
main image

Live-cell imaging of skeletal muscle from the MYH3 G769V collection (Clone 82). Cells express mEGFP-tagged alpha-actinin-2. After 35 days of primary differentiation from hiPSC to myogenic progenitors, cells were replated onto Matrigel coated cover glass and induced to differentiate into skeletal muscle. Cells were imaged 11 days after this replating on a spinning disk confocal microscope. Images were acquired in a 3 x 3 tiled Z stack and are presented as maximum intensity projections of 10 slices. Scale bars are 50µm. Image system details: Nikon Eclipse Ti microscope with a Yokogawa CSU-W1 spinning disk head imaging onto an Andor iXon 888 EMCCD. Objectives were either Nikon Plan Apo VC 60x/1.4 NA or Nikon Plan Apo 100x/1.4 NA. Skeletal muscle sample and images was courtesy of Alina Greimal, BS, Christian Mandrycky, PhD and David Mack, PhD Institute for Stem Cell & Regenerative Medicine (ISCRM) at the University of Washington.

thumbnail image
thumbnail image
thumbnail image
thumbnail image
cRNA Target Site:5’ CATAAGGTGTTCTTCAAGGC[TGG] 3’
DNA Donor Sequence:
5’ TCTGCCCCATAAGGTGTTCTTCAAGGCTG[T]CTTGCTGGGAACCCTGGAAGAGATGCGGG 3’
Cas9:TrueCut™ Cas9 Protein
F Primer for PCR/Sequencing:5’ TGACTCCGAGCTAGTTCCCT 3’
R Primer for PCR/Sequencing:5’ CTCCGACTTGGCGAGTTCAT 3’
Red = PAM Site, Blue = Mutation
HDR Editing Design: "Header Caption: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below."
HDR Editing Design: "Header Caption: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below."
Top: MYH3 locus showing 1 MYH3 isoform; Bottom: Zoom in on mutation site at isoform NM_0027470.4(MYH3):c.2306G>T(p.Gly769Val)
HDR Editing Design: "Header Caption: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below."
HDR Editing Design: "Header Caption: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below."
Top: ACTN2 locus showing 3 ACTN2 isoforms; Bottom: Zoom in on mEGFP insertion site at ACTN2 C-terminus