AICS-0097
SNPNM_000257.4(MYH7):c.767G>A(p.Gly256Glu)
Gene SymbolMYH7
Gene Namemyosin heavy chain 7
Parental LineAICS-0075 cl. 85 ACTN2
Clone NumberClone TypeReplicateGenotype
cl.102MutantAG256E/WT
cl.113ControlAWT/WT
cl.141MutantAG256E/WT
cl.157MutantBG256E/WT
cl.174ControlBWT/WT
Certificate of Analysis

Obtain AICS-0097

3 mutant clones2 isogenic controls

AICS-0097

MYH7 in WTC-mEGFP-ACTN2 (mono-allelic tag)
Representative images for all clones
main image

Live-cell imaging of cardiomyocytes with the G256E point mutation in the MYH7 locus introduced into the AICS-0075 cell line (which expresses mEGFP-tagged alpha-actinin-2). Twelve days after the onset of differentiation, cells were plated on PEI and laminin coated glass and imaged in 3D on a spinning disk confocal microscope 18 days later (30 days total after the onset of differentiation). A. clone 113 (wt/wt) and B. clone 141 (G256E/wt). Images are maximum intensity projections of 3 Z slices. Scale bar 10µm. Image system details: 3i (Denver, CO) spinning disk microscope with a Zeiss (Thornwood, NY) 63x/1.2 NA alpha-plan APOCHROMAT water objective, a CSU-W1 Yokogawa (Sugar Land, TX) spinning disk head, and Hammamatsu (Hammamatsu City, Japan) Orca Flash 4.0 camera.

thumbnail image
thumbnail image
cRNA Target Site:5’ TTTTGGGGCAACAGGAAAGT[TGG] 3’
DNA Donor Sequence:
5’ AATTCATTCGAATTCATTTTGGGGCAACAG[A]AAAGTTGGCATCTGCAGACATAGAGACC 3’
Cas9:TrueCut™ Cas9 Protein
F Primer for PCR/Sequencing: 5’ CCCAACTCATCACCACTCTC 3’
R Primer for PCR/Sequencing:5’ GGAGAGAGAGAGAGGTCAAG 3’
Red = PAM Site, Blue = Mutation
HDR Editing Design: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below.
HDR Editing Design: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below.
Top: MYH7 locus showing 1 MYH7 isoform; Bottom: Zoom in on mutation site at isoform NM_000257.4(MYH7):c.767G>A(p.Gly256Glu)
HDR Editing Design: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below.
HDR Editing Design: CRISPR-Cas9 methodology was used to introduce a single base pair mutation to MYH7, and mEGFP at C-terminus of ACTN2 as shown below.
Top: ACTN2 locus showing 3 ACTN2 isoforms; Bottom: Zoom in on mEGFP insertion site at ACTN2 C-terminus